skip to Main Content

SUMMARY This project will involve the creation of a Blockchain miner that does a

SUMMARY This project will involve the creation of a Blockchain miner that does all the following:Receives transactions from user or remote node. Sends transactions to a remote node. Manages incoming remote node messages using a Queue. Generates a Merkle Tree and an eventual Merkle Root as part of Transaction processing. Creates Blockchain Blocks using Proof of Work algorithm. For this project, you will create the main functionality inside of an existing code base called BlockchainBasics. The BlockchainBasics code that you…

read instruction in file assignment 2EX1:Client side:a) Currently, if the server

read instruction in file assignment 2EX1:Client side:a) Currently, if the server shuts down while a client is connected, the client does not respond, and continues to wait for messages. Modify the client so it responds to the shutdown of the server by printing a message saying the server has shut down, and quitting. Design hint: look at the methods called connectionClosed and connectionException.b) The client currently always uses a default port. Modify the client so that it obtains the port…

SUMMARY You will have two jsp pages, one that submits user entries to the other.

SUMMARY You will have two jsp pages, one that submits user entries to the other. You will also have a regular Java class that provides methods for the second JSP page to access. This lab will involve the following new features: Incorporating external Java classes into a web app. Handling submitted Request values in a separate JSP page. DETAILS Alrighty… More web app Development!This week, we’re going to expand our HTML a bit, and we’re going to expand our Java…

all info:https://s3.amazonaws.com/blackboard.learn.xythos.prod/584b12a1a0ed8/454

all info:https://s3.amazonaws.com/blackboard.learn.xythos.prod/584b12a1a0ed8/4547134?response-cache-control=private%2C%20max-age%3D21600&response-content-disposition=inline%3B%20filename%2A%3DUTF-8%27%27CSCI142_Term_Project.pdf&response-content-type=application%2Fpdf&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Date=20201028T210000Z&X-Amz-SignedHeaders=host&X-Amz-Expires=21600&X-Amz-Credential=AKIAYDKQORRYTKBSBE4S%2F20201028%2Fus-east-1%2Fs3%2Faws4_request&X-Amz-Signature=0d8721834016f6722ec05e19900793df17fc07f76c12d7c28bb14e085f7c2c3fMy Project idea is a video game

Programming Assignment 7/8 Scenario: After graduating from CLU, you are running

Programming Assignment 7/8 Scenario: After graduating from CLU, you are running your own consulting firm, providing computer services around the metro area. Your company charges clients by the hour, and your employees sometimes need to visit client sites. To do so, they have the option of driving their own car or taking a taxi or other ride sharing service. Your primary client wants a weekly summary of each consultant’s billable hours, and any travel expenses incurred each week (such as…

This exercise focuses on the two-finger walking algorithm for ordered lists. You

This exercise focuses on the two-finger walking algorithm for ordered lists. You will write a program called OrderedListDemo.java that can read a list of names from a file and construct an ordered list. You will be provided with the following starter files: OrderedList.java, list1.txt ,list2.txt. Examine these files and study the methods before proceeding. This exercise focuses on recursion. You will implement two static methods to solve two separate problems. All solutions must be recursive.

Pass fail. You will receive 25 points if some effort is shown. You will receive

Pass fail. You will receive 25 points if some effort is shown. You will receive 25 points for each of three problems you have working. You will receive up to 10 additional bonus points on each problem where you have made a significant change to your solution.If you do not present in class, you will need to submit a document presenting your work, including your code, the results from your code running, and any additional information.25 Oct 2020HW 7In Class…

An STR is a short sequence of nucleotides that tends to repeat consecutively num

An STR is a short sequence of nucleotides that tends to repeat consecutively numerous times at specific locations inside human DNA. The number of times any particular STR repeats varies a lot among individuals.In the DNA samples below, Taby has the STR AGAT repeated four times in her DNA, while Brice has the same STR repeated five times.Taby:CTAGATAGATAGATAGATGACTABrice:CTAGATAGATAGATAGATAGATTImplement a DNAStrand data type that represents DNA with linked Nucleotide nodes.1) DNAStrand(String dna)Constructs a new DNAStrand with the given dna string representing…